Skip to main content

First evidence of heteroplasmy in Grey Partridge (Perdix perdix)

Abstract

We report for the first time the occurrence of heteroplasmy in Grey Partridge (Perdix perdix) revealed by means of two mitochondrial fragments. The possible serious biological and management implications of this exception to unilateral inheritance of mtDNA were underlined.

Correspondence

The Grey Partridge (Perdix perdix Linnaeus, 1758) is a polytypic Galliform species included in the Least Concern (LC) category of the IUCN Red List of Threatened Species at both global (Staneva and Burfield 2017) and national scale (Peronace et al. 2012). Considering that, to date, Grey Partridge’s population genetics is based on mtDNA (Andersen and Kahlert 2012), and that heteroplasmy has been previously described specifically in hybrids and other Galliform species (Barr et al. 2005; Gandolfi et al. 2017), we decided to investigate the presence of this phenomenon in P. perdix.

During this research, both wild and farm animals were analyzed (102 samples, Additional file 1); as concerns wild animals, both present and historical (see Gandolfi et al. 2017 for “historical” definition), P. perdix samples were characterized, whereas as to contemporary live samples, non-invasive specimens belonged both to husbandries or were sampled in nature (feather or faeces).

DNA was extracted through a specifically modified protocol (Lucentini et al. 2010), and two mitochondrial genes, Cytochrome Oxidase Subunit I (COI) and Control Region (CR/D-loop), were amplified (Kerr et al. 2007; Barbanera et al. 2009) and Sanger sequencing was outsourced for both ends of amplicons to Eurofins Genomics.

All sequences of 561 bp for D-loop and of 334 bp for COI were screened manually looking for double peaks in order to evaluate the presence and to validate point heteroplasmy (Ramos et al. 2013). We found out that, out of 102 individuals, nine showed point heteroplasmy in the D-loop fragment (Fig. 1A), and two in COI gene. Both mutations are missense, causing in the first case the substitution of an Isoleucine (AUU) by a Serine (AGU) while in the other case a Glycine (CAA) was substituted by an Arginine (CGA).

Fig. 1
figure1

A Example of D-loop heteroplasmy in Perdix samples. Example of polymorphic site (b) (GenBank MN413492), clearly showing mtDNA heteroplasmy compared with homoplasmic samples for this site (a) (GenBank MN413497) (c) (GenBank MN413494). B Electropherogram of one of the cloned samples and of two related clones (MN413488–MN413489)

Different haplotypes were retrieved and deposited in GenBank (Accession Numbers MN413488–MN413500, MT649222–MT649228 for D-loop and MN480303–MN480304, MT649229–MT649247 for COI).

Specimens presenting clear heteroplasmic D-loop single mutation sites and others showing electropherograms suggesting D-loop heteroplasmy insertion/deletion, were cloned using pGEM-T Easy vector (Promega) following the manufacturer’s instructions. The analysis of clones strongly confirms the presence of heteroplasmy and the absence of any contamination. In fact, obtained clones, when sequenced, showed two different haplotypes, confirming the presence of more than one mtDNA in each cloned sample (Fig. 1B).

Furthermore, to rule out possible contaminations, 39 individuals, including the nine heteroplasmic ones, were genotyped with a nuclear gene, the Oocyte maturation factor (c-mos) using both primers appropriately designed for this purpose (CMOS2F; F5′-3′GCTGTGAAGCAAGTGAAGAA; CMOS2 R; R5′-3′AGCCGAAGTCTCCAATCTT) and those described by Shen et al. (2014). The analysis of this nuclear locus never showed any double peaks and/or signal superimposition, thus excluding the presence of sample contamination. Obtained related sequences were registered in GenBank (MN442418–MN442421).

In conclusion, this study provides the first evidence of mitochondrial heteroplasmy in Perdix perdix, a phenomenon that can create some ambiguities in phylogenetic and evolutionary interpretations. In fact, paternal mtDNA could lead to inaccurate estimates of divergence times if the molecular clock is used, and could confuse the putative haplogroup assignment. Furthermore, the data obtained, suggesting the occurrence of hybridization in Perdix perdix, strongly underlined the importance of the rapid adoption of control measures aimed to prevent the introduction of genomes from different geographical areas and to avoid the concrete risk of an extinction vortex to which the residual, small and isolated populations are segregated.

Further researches should focus to advance the knowledge on the hybridization scheme of Perdix species and on the possible interfertile species, to better understand the evolutionary history of the species and its management.

Availability of data and materials

Sample number and origin of each sample was reported. In particular a geographical origin or a museum/collection collocation was specified, if applicable. Furthermore, details about GenBank code on D-Loop, COI and c-mos fragment were provided. Different haplotypes were retrieved and deposited in GenBank (Accession Numbers MN413488–MN413500, MT649222–MT649228 for Dloop, MN480303–MN480304, MT649229–MT649247 for COI and MN442418–MN442421 for c-mos).

References

  1. Andersen LW, Kahlert J. Genetic indications of translocated and stocked grey partridges (Perdix perdix): does the indigenous Danish grey partridge still exist? Biol J Linn Soc. 2012;105:694–710.

    Article  Google Scholar 

  2. Barbanera F, Guerrini M, Khan AA, Panayides P, Hadjigerou P, Sokos C, et al. Human-mediated introgression of exotic chukar (Alectoris chukar, Galliformes) genes from East Asia into native Mediterranean partridges. Biol Invas. 2009;11:333–48.

    Article  Google Scholar 

  3. Barr CM, Neiman M, Taylor DR. Inheritance and recombination of mitochondrial genomes in plants, fungi and animals: Research review. New Phytol. 2005;168:39–50.

    CAS  Article  Google Scholar 

  4. Gandolfi A, Crestanello B, Fagotti A, Simoncelli F, Chiesa S, Girardi M, et al. New evidences of mitochondrial DNA heteroplasmy by putative paternal leakage between the Rock Partridge (Alectoris graeca) and the Chukar Partridge (Alectoris chukar). PLoS ONE. 2017;12:e0170507.

    Article  Google Scholar 

  5. Kerr KCR, Stoeckle MY, Dove CJ, Weigt LA, Francis CM, Hebert PDN. Comprehensive DNA barcode coverage of North American birds. Mol Ecol Notes. 2007;7:535–43.

    CAS  Article  Google Scholar 

  6. Lucentini L, Gigliarelli L, Puletti ME, Volpi L, Panara F. Comparison of conservative DNA extraction methods for two Galliformes: grey partridge (Perdix perdix italica, Hartert 1917) and red-legged partridge (Alectoris rufa, Linnaeus 1758). Conserv Genet Resour. 2010;2:381–4.

    Article  Google Scholar 

  7. Peronace V, Cecere J, Gustin M, Rondinini C. Lista rossa degli uccelli nidificanti in Italia. Avocetta. 2012;36:11–58.

    Google Scholar 

  8. Ramos A, Santos C, Mateiu L, del Mar Gonzalez M, Alvarez L, Azevedo L, et al. Frequency and pattern of heteroplasmy in the complete human mitochondrial genome. PLoS ONE. 2013;8:e74636.

    CAS  Article  Google Scholar 

  9. Shen Y-Y, Dai K, Cao X, Murphy RW, Shen X-J, Zhang Y-P. The updated phylogenies of the Phasianidae based on combined data of nuclear and mitochondrial DNA. PLoS ONE. 2014;9:e95786.

    Article  Google Scholar 

  10. Staneva A, Burfield I. European birds of conservation concern. Populations, trends and national responsibilities. Cambridge: BirdLife International; 2017. p. 170.

    Google Scholar 

Download references

Acknowledgements

Authors would like to thank the Natural History Museum of the University of Pisa, the Civic Museum of Zoology of Rome, the Casalina’s Gallery of Natural History and the Natural History Museum of Fisiocritici of Siena.

Funding

Not applicable.

Author information

Affiliations

Authors

Contributions

AA, PV and LL conceived and designed the research. PV, PS and AA acquired samples. CP, FG and LL performed the sample analysis. LL, AF and AA analyzed the data. PV, LL, CP, FS, IDR and AA conducted manuscript preparation, revising and analysis of intellectual contents. LL and AA contributed equally to the extent of this research. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Livia Lucentini.

Ethics declarations

Ethics approval and consent to participate

The performed sampling procedures and analyses are consistent with the Directive 2010/63/EU, the Italian national regulations and the indications of the Ethics Committee of the Universities of Perugia and Viterbo (Italy). The approval by the Ethics Committee was not necessary because of the nature of the samples (museal individuals) and of the non-invasive in vivo sampling method. In fact, just two feathers were collected from live animals excluding those having a functional role. Birds were immediately released at the same sampling site. The sampling campaign was authorized by local authorities with the scientific ISPRA authorization number 12184.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Supplementary information

Additional file 1.

Data about samples used in this study.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Pizzirani, C., Viola, P., Gabbianelli, F. et al. First evidence of heteroplasmy in Grey Partridge (Perdix perdix). Avian Res 11, 27 (2020). https://doi.org/10.1186/s40657-020-00213-w

Download citation

Keywords

  • Galliformes
  • Grey Partridge
  • Heteroplasmy
  • Hybridization
  • Perdix perdix