Skip to main content

Table 2 Oligonucleotide sequences (5′–3′) used as PCR primers in this study

From: A multilocus molecular phylogeny for the avian genus Liocichla (Passeriformes: Leiothrichidae: Liocichla)

Oligonucleotide name 5′-CS tag + target sequence (5′ → 3′) Locus description Location References
CS1-12630F ACACTGACGACATGGTTCTACACAGCAGATCCTCAACGTCTC Magmas-like protein Autosomal ch: 14 [34]
CS2-12630R TACGGTAGCAGAGACTTGGTCTCTGCAGGTAGAAGGAGCCTC Magmas-like protein Autosomal ch: 14 [34]
CS1-Liocichla_CS12630_F1 ACACTGACGACATGGTTCTACACAAGTGGTCGTAGTTCTGCC Magmas-like protein Autosomal ch: 14 This study
CS2-Liocichla_CS12630_R1 TACGGTAGCAGAGACTTGGTCTGAGATCCAGAAGGTAGAGGC Magmas-like protein Autosomal ch: 14 This study
CS1-14572F ACACTGACGACATGGTTCTACACAGTAAAGAAACAGAAGTCC Phosphotyrosyl phosphatase Autosomal ch: 1 [34]
CS1-14572R TACGGTAGCAGAGACTTGGTCTACTGCTGTGTGTTAGACTG Phosphotyrosyl phosphatase Autosomal ch: 1 [34]
CS1-Liocichla_CS14572_F1 ACACTGACGACATGGTTCTACAGTCCTCGAGACTCACATTCA Phosphotyrosyl phosphatase Autosomal ch: 1 This study
CS2-Liocichla_CS14572_R1 TACGGTAGCAGAGACTTGGTCTGCCATTCCTTCATAAGCTGC Phosphotyrosyl phosphatase Autosomal ch: 1 This study
CS1-23361F ACACTGACGACATGGTTCTACAAAAGCTTATCAGGAGACCTC Myeloid leukemia factor 2 Autosomal ch: 1 [34]
CS2-23361R TACGGTAGCAGAGACTTGGTCTTTGATGTAGTCCTGCCTCTC Myeloid leukemia factor 2 Autosomal ch: 1 [34]
CS1-Liocichla_CS23361_F1 ACACTGACGACATGGTTCTACAAGCCGCTGTCCGAGTCCCTT Myeloid leukemia factor 2 Autosomal ch: 1 This study
CS2-Liocichla_CS23361_R1 TACGGTAGCAGAGACTTGGTCTCCCGCAGCACTTTGGCTTTGC Myeloid leukemia factor 2 Autosomal ch: 1 This study
CS1-TGFB2F5 ACACTGACGACATGGTTCTACAGAAGCGTGCTCTAGATGCTG Transforming growth factor β2 Autosomal ch: 3 [35]
CS2-TGFB2R6 TACGGTAGCAGAGACTTGGTCTAGGCAGCAATTATCCTGCAC Transforming growth factor β2 Autosomal ch: 3 [35]
CS1-Liocichla_TGF_F1 ACACTGACGACATGGTTCTACATGCACACCCTCATTGTCAGACCCA Transforming growth factor β2 Autosomal ch: 3 This study
CS2-Liocichla_TGF_R1 TACGGTAGCAGAGACTTGGTCTACAGGCAGGCAAGTCTGAGTCAC Transforming growth factor β2 Autosomal ch: 3 This study
CS1-FIB5F ACACTGACGACATGGTTCTACACGCCATACAGAGTATACTGTGACAT β-fibrinogen intron 5 Autosomal ch: 4 [36]
CS2-FIB5R TACGGTAGCAGAGACTTGGTCTGCCATCCTGGCGATTCTGAA β-fibrinogen intron 5 Autosomal ch: 4 [36]
CS1-L5216 ACACTGACGACATGGTTCTACAGGCCCATACCCCGRAAATG Mitochondrially encoded NADH dehydrogenase 2 Mitochondrial [38]
CS2-H6313 TACGGTAGCAGAGACTTGGTCTACTCCTRTTTAAGGCTTTGAAGGC Mitochondrially encoded NADH dehydrogenase 2 Mitochondrial [38]
CS1-L10755 ACACTGACGACATGGTTCTACAGACTTCCAATCTTTAAAATCTGG Mitochondrially encoded NADH dehydrogenase 3 Mitochondrial [39]
CS2-H11151 TACGGTAGCAGAGACTTGGTCTGATTTGTTGAGCCGAAATCAAC Mitochondrially encoded NADH dehydrogenase 3 Mitochondrial [39]
CS1-L14851 ACACTGACGACATGGTTCTACACCTACTTAGGATCATTCGCCCT Mitochondrially encoded cytochrome b Mitochondrial [40]
CS2-Hb745 TACGGTAGCAGAGACTTGGTCTTTTCTGGGTCTCCTAGTAGGTT Mitochondrially encoded cytochrome b Mitochondrial [41]
CS1-Liocichla_cytb_F1 ACACTGACGACATGGTTCTACACATATGCCGAAACGTCCA Mitochondrially encoded cytochrome b Mitochondrial This study
CS1-Liocichla_cytb_F2 ACACTGACGACATGGTTCTACACTTTCACATCGGCCGAGG Mitochondrially encoded cytochrome b Mitochondrial This study
CS2-Liocichla_cytb_R1 TACGGTAGCAGAGACTTGGTCTCCTCAGAATGATATTTG Mitochondrially encoded cytochrome b Mitochondrial This study
CS2-Liocichla_cytb_R2 TACGGTAGCAGAGACTTGGTCTGTCATTCTACTAGGG Mitochondrially encoded cytochrome b Mitochondrial This study
CS2-Liocichla_cytb_R3 TACGGTAGCAGAGACTTGGTCTTAGTGGGTTGTTTGATCC Mitochondrially encoded cytochrome b Mitochondrial This study
CS2-Liocichla_cytb_R4 TACGGTAGCAGAGACTTGGTCTGGTGTAGTAGGGGTGGAA Mitochondrially encoded cytochrome b Mitochondrial This study
  1. All oligonucleotides were synthesized by Integrated DNA Technologies (IDT) at the 25 nmole scale and purified by a standard desalting protocol. All oligonucleotides were tagged at the 5′ end with common sequence tags, either CS1 (5′-ACACTGACGACATGGTTCTACA) in the forward direction or CS2 (5′-TACGGTAGCAGAGACTTGGTCT) in the reverse direction. Locations for each locus are based on homology with the chicken (Gallus gallus) genome determined from an NCBI ‘gene’ search of the locus description in the case of transforming growth factor β2 and β-fibrinogen intron 5. For the remainder of the nuclear autosomal loci location was determined from the literature [34]. Internal oligonucleotides designed specifically to match conserved sequences for our samples (Liocichla and outgroups) are prefaced with ‘Liocichla’ in the oligonucleotide name.